rs34221390 chr2:121282349 G>C
- Sequence
aaaaaaaaaaaaaaaaaaaatgaa[G/C]tcatcatcctgcgacttagggagg
- ASB in cell types
- renal cortex
- ASB for transcription factors
- CREB1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CREB1_HUMAN | 2.46 | -2.49 | 1.00 | -5.55 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
