rs342292 chr7:106730198 C>G
- Sequence
aggtggtacagttccaggtgatga[C/G]aggttccaaggtgtgtcatgaaag
- ASB in cell types
- MDM(monocyte derived macrophages) monocyte-derived macrophages from peripheral blood Detroit 562 (Pharyngeal squamous cell carcinoma)
- ASB for transcription factors
- SPI1_HUMAN TF65_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 3.13 | 0.19 | 1.62 | n/a | No Hit | |||
| TF65_HUMAN | 1.43 | -0.69 | 1.50 | n/a | No Hit |
Items per page:
1 – 2 of 2