rs342297 chr7:106732492 T>C
- Sequence
cagagcacttcctcccaaagaccg[T/C]gttaacctttctccctattgtcaa
- ASB in cell types
- MDM(monocyte derived macrophages) monocyte-derived macrophages from peripheral blood
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 0.96 | 2.17 | 1.27 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), ldl cholesterol, ldl cholesterol change with statins, microalbuminuria, total cholesterol change with statins