rs34274024 chr4:3942526 T>C
- Sequence
ctttggttatggacacataactcc[T/C]gggccagaggctaaaaccccaggg
- ASB in cell types
- 22RV1 (prostate carcinoma) GM18951 (B-cells Lymphoblastoid Cell Lines) upper lobe of left lung HCT-116 (colon carcinoma)
- ASB for transcription factors
- CTCF_HUMAN RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.59 | 0.12 | 1.27 | n/a | No Hit | |||
| RAD21_HUMAN | 1.72 | -0.03 | 1.25 | n/a | n/a |
Items per page:
1 – 2 of 2