rs34287864 chr12:56464533 G>A
- Sequence
gccactgcactccaaactggtggc[G/A]aggccgggcgggaggccaagacgg
- ASB in cell types
- K562 (myelogenous leukemia) PC9 (lung adenocarcinoma) CD34+ hematopoietic stem cells KMS-11 (Plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.21 | 0.98 | 2.00 | |||
| PC9 (lung adenocarcinoma) | 0.06 | 1.05 | 2.00 | |||
| CD34+ hematopoietic stem cells | 2.92 | 0.24 | 2.00 | |||
| KMS-11 (Plasma cell myeloma) | 1.64 | n/a | 3.67 | |||
| epidermal keratinocytes | 2.35 | 0.23 | 2.00 |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cerebellar_Hemisphere, Colon_Sigmoid, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Testis, Thyroid, Whole_Blood