rs342931 chr3:146577772 C>T
- Sequence
cacaaaattgatgtgttttatttc[C/T]cagattacagaaagaacaaaatga
- ASB in cell types
- GM12892 (female B-cells lymphoblastoid cell line) MS-1 (Small cell lung carcinoma) GM18951 (B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12892 (female B-cells lymphoblastoid cell line) | 0.05 | 1.13 | 1.00 | |||
| MS-1 (Small cell lung carcinoma) | -0.84 | 0.88 | 1.00 | |||
| GM18951 (B-cells Lymphoblastoid Cell Lines) | -0.59 | 1.37 | 1.00 |
Items per page:
1 – 3 of 3