rs342940 chr3:146641462 T>C
- Sequence
atacaatttggaaactatttctga[T/C]gcataccccattataaacaatagg
- ASB in cell types
- foreskin keratinocyte hepatocytes erythroid progenitors OCI-LY7 (diffuse large B-cell lymphoma)
- ASB for transcription factors
- FOXP1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXP1_HUMAN | -1.86 | 2.66 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, total cholesterol change with statins, triglycerides, waist hip ratio, years of education