rs343109 chr5:73565541 G>A
- Sequence
tctctccttttttttaatattttt[G/A]tttttgccgcctttacgctccgag
- ASB in cell types
- K562 (myelogenous leukemia) 22RV1 (prostate carcinoma) MCF7 (Invasive ductal breast carcinoma) breast tumor
- ASB for transcription factors
- ANDR_HUMAN NR2C1_HUMAN ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 2.68 | -3.92 | 2.00 | 1.82 | Weak Discordant | |||
| NR2C1_HUMAN | 2.41 | -0.34 | 1.67 | n/a | No Hit | |||
| ESR1_HUMAN | 1.60 | 0.01 | 2.43 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GRASP body mass index (bmi), fasting blood glucose, ldl cholesterol, urinary albumin-to-creatinine ratio