rs34322 chr12:12726636 T>C
- Sequence
tcttgctgcagtgtatcggacgag[T/C]ttaaccagatatccagcactagcc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | n/a | 1.75 | 1.25 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP comorbid depressive syndrome and alcohol dependence, diastolic blood pressure (dbp), fasting insulin, height, homa-b, homa-ir, neuroblastoma (brain cancer), systolic blood pressure (sbp), triglycerides
GTEx eQTL Adipose_Subcutaneous, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Stomach, Testis, Whole_Blood