rs34347156 chr3:151290927 T>C
- Sequence
tgaattctgcatctactatgatac[T/C]tgtattatgttgaaaatcgaaaat
- ASB in cell types
- adrenal gland hASC (preadipocytes)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| adrenal gland | 1.33 | -0.78 | 1.00 | |||
| hASC (preadipocytes) | 1.51 | 0.06 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Aorta, Esophagus_Mucosa, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid