rs34358 chr5:75669297 G>A
- Sequence
atggccacagggctctgcttatct[G/A]gctacacgggaccctgatgactca
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.16 | 1.03 | 1.98 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | -4.44 | 2.61 | 1.50 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, advanced age-related macular degeneration (geographic atrophy), alzheimers disease, body mass index (bmi), comorbid depressive syndrome and alcohol dependence, diastolic blood pressure (dbp), eye color, hdl cholesterol, hypertension (early onset hypertension), ldl cholesterol, plasma aldosterone concentration corrected by plasma renin activity, rheumatoid arthritis, serum brain derived neurotrophic factor concentration, total cholesterol, years of education
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Nerve_Tibial, Pancreas, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid