rs34408730 chr17:7435581 G>A
- Sequence
aggtagacaaggggcggcagcgga[G/A]gctggctactgcattccgtaggag
- ASB in cell types
- GM02255 (Lymphoblastoid Cell Lines) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02255 (Lymphoblastoid Cell Lines) | -1.21 | 1.80 | 1.00 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.54 | 0.86 | 1.29 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid