rs344550 chr19:6682942 C>G
- Sequence
aatgccagaagtgaacttcaaaga[C/G]agcataaatggagttatcaaagaa
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.27 | 0.72 | 1.99 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, cystatin c in serum, hdl cholesterol, ldl cholesterol, lung function, forced expiratory volume in 1 second (fev1) percent predicted (in asthmatic participants), triglycerides