rs345160 chr17:60174803 C>T
- Sequence
ggtgtgtcccagtaaaattctgta[C/T]tcagcctccaaactagctgggaaa
- ASB in cell types
- 2588 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.70 | -0.63 | 1.20 | n/a | No Hit | |||
| STAG1_HUMAN | 1.51 | -0.63 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP cystatin c in serum, height, homa-b, infant head circumference, microalbuminuria, total cholesterol, waist hip ratio
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Brain_Cerebellum, Brain_Cortex, Brain_Hippocampus, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Left_Ventricle, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood