rs34523874 chr16:579447 A>G
- Sequence
aggccctagaggtgccccgggccc[A/G]gagactagagatgccccgggcccg
- ASB in cell types
- foreskin keratinocyte gastroesophageal sphincter GM02255 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 2.18 | -3.48 | 1.50 | |||
| gastroesophageal sphincter | 2.27 | -2.27 | 1.00 | |||
| GM02255 (Lymphoblastoid Cell Lines) | 0.97 | -0.92 | 1.00 |
Items per page:
1 – 3 of 3