rs34553446 chr11:1837952 G>A
- Sequence
gcctttaggggctcagtcctggcc[G/A]gatgcccctcccagtccccacaca
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) THP-1 (acute monocytic leukemia) monocyte-derived macrophages from peripheral blood transverse colon
- ASB for transcription factors
- IKZF1_HUMAN SMCA5_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF1_HUMAN | 2.80 | 0.82 | 1.00 | n/a | No Hit | |||
| SMCA5_HUMAN | 2.52 | -2.19 | 1.50 | n/a | No Hit |
Items per page:
1 – 2 of 2