rs34572011 chr7:107890758 C>T
- Sequence
gcagttatctctcctttgtgagac[C/T]ttgggggcactgtttaacctctct
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells lymphoblastoid cell line) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.77 | -0.01 | 1.47 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.95 | 0.86 | 1.02 | |||
| HEK293 (embryonic kidney) | 0.99 | 0.11 | 1.98 |
Items per page:
1 – 3 of 3