rs34583792 chr4:3942457 C>T
- Sequence
tgttccggaagaacctgcgggagt[C/T]gcagcagctccgatgggatgagag
- ASB in cell types
- GM18951 (B-cells Lymphoblastoid Cell Lines) ID00014 (lymphoblastoid cell, DiGeorge syndrome) GM12878 (female B-cells lymphoblastoid cell line) GM19240 (B cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.66 | 1.41 | 1.44 | -2.07 | Concordant | |||
| STAG1_HUMAN | 2.18 | 1.76 | 1.79 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
