rs34595304 chr19:57104130 T>A
- Sequence
cacgatttcattatctgccttgca[T/A]gagtgagcctgagtttctgtagca
- ASB in cell types
- HepG2 (hepatoblastoma) neural cell HMEC (human mammary epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.76 | 0.27 | 1.07 | |||
| neural cell | -0.67 | 1.48 | 1.00 | |||
| HMEC (human mammary epithelial cells) | -0.42 | 1.27 | 1.00 |
Items per page:
1 – 3 of 3