rs34625711 chr11:7657383 G>A
- Sequence
cagcactgcctgactctatctccc[G/A]tcatctgcaaggggtatctgtgcg
- ASB in cell types
- GM19238 (female B-cells lymphoblastoid cell lines) SK-N-SH (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19238 (female B-cells lymphoblastoid cell lines) | -0.72 | 1.25 | 1.00 | |||
| SK-N-SH (neuroblastoma) | -3.14 | 1.87 | 1.33 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Cells_Cultured_fibroblasts, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood