rs34649579 chr17:57988807 T>A
- Sequence
aagccctctgcgctctcgctatga[T/A]atgcatctcatggcgagatggcct
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.27 | 0.87 | 1.72 | |||
| K562 (myelogenous leukemia) | 2.77 | -5.29 | 2.00 |
Items per page:
1 – 2 of 2