rs34651 chr5:72848178 C>T
- Sequence
ccgcggcggcagcagcagcagacg[C/T]tggcggccgggctgccaggagcag
- ASB in cell types
- HepG2 (hepatoblastoma) primary B-CLL cells A549 (lung carcinoma)
- ASB for transcription factors
- BRD4_HUMAN JUN_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRD4_HUMAN | 0.06 | 1.99 | 1.33 | n/a | n/a | |||
| JUN_HUMAN | 1.22 | 0.08 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
EMBL-EBI chronic obstructive pulmonary disease, height, mean platelet volume, red cell distribution width
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Whole_Blood