rs34689 chr5:34007604 A>C
- Sequence
agttttggacaatccagtttggga[A/C]gaatgatcactaacaataccctag
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) GM19240 (B cells Lymphoblastoid Cell Lines) LNCaP C4-2B (prostate carcinoma) 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.61 | 0.95 | 1.06 | |||
| GM19240 (B cells Lymphoblastoid Cell Lines) | -1.44 | 1.78 | 1.00 | |||
| LNCaP C4-2B (prostate carcinoma) | -0.11 | 1.44 | 1.00 | |||
| 22RV1 (prostate carcinoma) | 2.02 | -0.30 | 2.00 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP birth weight, comorbid depressive syndrome and alcohol dependence, maternal transmission distortion, paternal transmission distortion, transmission distortion, triglycerides
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Cortex, Brain_Frontal_Cortex_BA9, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Thyroid, Whole_Blood