rs34704162 chr1:112825120 C>A
- Sequence
agagaagagagggtagagacatgg[C/A]gggaaggggttgggtgagcagccc
- ASB in cell types
- HEK293T (embryonic kidney)
- ASB for transcription factors
- ZN534_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN534_HUMAN | 2.40 | -2.08 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Anterior_cingulate_cortex_BA24, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Frontal_Cortex_BA9, Brain_Spinal_cord_cervical_c-1, Cells_Cultured_fibroblasts, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Spleen