rs34763604 chr2:101697147 G>C
- Sequence
gcccctcctccgctcggcaacacc[G/C]ggttcgggtccctctagagccggg
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.02 | 0.87 | 1.99 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Caudate_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Cells_Cultured_fibroblasts, Heart_Left_Ventricle, Liver, Muscle_Skeletal, Pancreas, Skin_Sun_Exposed_Lower_leg, Whole_Blood