rs34850685 chr16:19583685 C>G
- Sequence
gcagtgagccgagatcgcactaca[C/G]cactccagcctgggtgacagagtg
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line) GM18526 (B – cells Lymphoblastoid Cell Lines) GM19240 (B cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19239 (male B-cells lymphoblastoid cell line) | 2.93 | -2.59 | 1.00 | |||
| GM18526 (B – cells Lymphoblastoid Cell Lines) | 2.41 | -2.11 | 1.00 | |||
| GM19240 (B cells Lymphoblastoid Cell Lines) | 1.44 | -1.44 | 1.00 |
Items per page:
1 – 3 of 3