rs34946530 chr14:25151103 C>T
- Sequence
caagttgggtttgacttctactaa[C/T]gtagtagtctgacccctagtggtt
- ASB in cell types
- GM19099 (female B-cells Lymphoblastoid Cell Lines) MCF10CA1a (breast metastatic epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19099 (female B-cells Lymphoblastoid Cell Lines) | 0.96 | -0.60 | 1.00 | |||
| MCF10CA1a (breast metastatic epithelial cells) | 1.87 | -1.55 | 1.00 |
Items per page:
1 – 2 of 2