rs34977626 chr2:166407997 T>G
- Sequence
ttggatttctgttcctgtttcagt[T/G]ttcagaggatgatggctaaatctg
- ASB in cell types
- MDM(monocyte derived macrophages) CD14+ monocytes monocyte-derived dendritic cells
- ASB for transcription factors
- SPI1_HUMAN STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.88 | 0.33 | 1.98 | n/a | No Hit | |||
| STAT1_HUMAN | 2.73 | n/a | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2