rs35015218 chr15:74799846 A>C
- Sequence
gctaactttcctccagccactcac[A/C]gacctgcatgctcagaagcgtgtg
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line) GM19099 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19239 (male B-cells lymphoblastoid cell line) | -1.18 | 1.91 | 1.00 | |||
| GM19099 (female B-cells Lymphoblastoid Cell Lines) | 1.80 | -1.41 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Lung, Nerve_Tibial, Pancreas, Testis, Whole_Blood