rs35018943 chr9:137614850 G>T
- Sequence
gcgccggagccctgccctcaggat[G/T]gcagccctgcctcacacccgctgc
- ASB in cell types
- T47D (invasive ductal carcinoma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.57 | 1.22 | 1.04 | -4.62 | Discordant |
Items per page:
1 – 1 of 1
Motif analysis
