rs35061594 chr4:70516088 G>A
- Sequence
ctggctagggcatgtccgattccc[G/A]ctgagggttggagtcatgtctgca
- ASB in cell types
- HMLE-Twist-ER (breast cancer)
- ASB for transcription factors
- SMAD3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMAD3_HUMAN | 3.08 | -1.91 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Esophagus_Mucosa, Minor_Salivary_Gland, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid