rs35202074 chr19:1837961 G>A
- Sequence
ctgctgtcccaaggcttacagctc[G/A]aggctaggggacagggacggtaac
- ASB in cell types
- foreskin keratinocyte MM1.S (plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | n/a | 1.97 | 3.00 | |||
| MM1.S (plasma cell myeloma) | 2.19 | -0.53 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Cortex, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Muscularis, Muscle_Skeletal, Spleen, Testis