rs35213459 chr7:154640655 C>T
- Sequence
tgaccccttggtcatcactgtcac[C/T]ggtgtgcgtgctccaccaggtggc
- ASB in cell types
- K562 (myelogenous leukemia) GM19193 (female B-cells Lymphoblastoid Cell Lines) RH4 (alveolar rhabdomyosarcoma) SYO-1(Biphasic synovial sarcoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.07 | 0.65 | 1.53 | |||
| GM19193 (female B-cells Lymphoblastoid Cell Lines) | -1.14 | 2.41 | 1.00 | |||
| RH4 (alveolar rhabdomyosarcoma) | -4.83 | 2.42 | 2.00 | |||
| SYO-1(Biphasic synovial sarcoma) | n/a | 1.91 | 2.00 |
Items per page:
1 – 4 of 4