rs35266643 chr2:23351801 C>T
- Sequence
gccacgcagcctgccctcctctcc[C/T]ggggaggggagatctgctcagcaa
- ASB in cell types
- HEK293 (embryonic kidney) suprapubic skin
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.25 | 0.97 | 1.53 | |||
| suprapubic skin | n/a | 2.49 | 1.00 |
Items per page:
1 – 2 of 2