rs35339521 chr2:230824803 G>A
- Sequence
atgtcgtggacccaaatgccctga[G/A]cgtcctggacgcctttttgagcaa
- ASB in cell types
- foreskin keratinocyte prostate gland
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.45 | -2.87 | 2.00 | |||
| prostate gland | -1.11 | 1.70 | 1.00 |
Items per page:
1 – 2 of 2