rs35360 chr12:115167199 G>A
- Sequence
cctccactggaaaattagaggggc[G/A]ttactggaaatgaccactccagtg
- ASB in cell types
- WA09 (embryonic stem cells) HUES64 (embryonic stem cells) hepatocytes
- ASB for transcription factors
- RAD21_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RAD21_HUMAN | 1.24 | 0.11 | 1.35 | n/a | n/a | |||
| CTCF_HUMAN | 1.08 | 0.21 | 1.32 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, diastolic blood pressure (dbp), serum creatinine, systolic blood pressure (sbp)