rs35551904 chr20:59525783 G>T
- Sequence
tgcgcccgatgtccggccgaaggc[G/T]cgggctgcggacgagggagagggt
- ASB in cell types
- WA01 (H1, human embryonic stem cells) Jurkat (T-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| WA01 (H1, human embryonic stem cells) | 1.78 | -0.80 | 1.17 | |||
| Jurkat (T-cells) | 1.87 | -0.55 | 1.00 |
Items per page:
1 – 2 of 2