rs35625 chr16:16075709 C>T
- Sequence
ccccttccctgtgccctcgtacca[C/T]acttcctgttccgtatcctctttt
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- SPI1_HUMAN ETS1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.46 | -0.17 | 1.63 | -3.04 | Concordant | |||
| ETS1_HUMAN | 2.46 | -2.49 | 1.00 | -2.77 | Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP aortic valve calcium, cognitive response of healthy volunteers to topiramate treatment as measure by the symbol search cognitive test, cognitive response of healthy volunteers to topiramate treatment as measure by the trailsb cognitive test, hdl cholesterol, triglycerides