rs35680343 chr4:165031982 T>G
- Sequence
cggtggagcagccaaccaccgcgc[T/G]ggtcaattgtatgcctaaaactcg
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- NRF1_HUMAN GABP1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NRF1_HUMAN | 2.31 | -0.72 | 2.00 | n/a | No Hit | |||
| GABP1_HUMAN | 2.60 | n/a | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Nerve_Tibial, Testis, Thyroid