rs35760652 chr19:2546436 G>A
- Sequence
cagggccgtggggcccagggctgc[G/A]ggcgggagggcctctgccacatgg
- ASB in cell types
- EOL-1 (Acute myeloid leukemia) MOLM14 (Adult acute myeloid leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| EOL-1 (Acute myeloid leukemia) | 1.62 | -0.64 | 2.00 | |||
| MOLM14 (Adult acute myeloid leukemia) | 0.54 | 1.53 | 2.00 |
Items per page:
1 – 2 of 2