rs35840 chr3:64029228 C>A
- Sequence
tgaatagcaggctgaaatcaggag[C/A]aaggaggggcaggagaaacagagg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | -0.20 | 1.53 | 6.00 |
Items per page:
1 – 1 of 1