rs35849718 chr2:232440673 C>T
- Sequence
acagccctgctctttcaccctgcc[C/T]gcctggtggcctccttagcctgca
- ASB in cell types
- COLO-829 (melanoma) CD34+ stem cells-derived erythroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| COLO-829 (melanoma) | 2.58 | -1.59 | 2.00 | |||
| CD34+ stem cells-derived erythroblasts | 2.48 | -0.70 | 2.00 |
Items per page:
1 – 2 of 2