rs35863323 chr19:33147735 T>C
- Sequence
acgtatgcctgtccagtgggggcg[T/C]tggttgcagcccaggggcttgacc
- ASB in cell types
- GM02630 (Fanconi anemi) GM02255 (Lymphoblastoid Cell Lines) GM19239 (male B-cells lymphoblastoid cell line) GM19240 (B cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | -2.38 | 2.93 | 1.17 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Frontal_Cortex_BA9, Brain_Nucleus_accumbens_basal_ganglia, Liver, Muscle_Skeletal