rs35942 chr5:54307763 G>C
- Sequence
cagcccaaagaacaatgaacaata[G/C]atacatacacacacacagctctct
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.07 | 0.94 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), chronic kidney disease, ldl cholesterol, serum creatinine, systolic blood pressure (sbp), total cholesterol