rs36039295 chr14:90826986 G>A
- Sequence
tggtgaggcatacagacacttctg[G/A]ttattatctttctcccaaatcaaa
- ASB in cell types
- T47D (invasive ductal carcinoma)
- ASB for transcription factors
- GATA3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA3_HUMAN | -1.38 | 1.86 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Cerebellum, Cells_Cultured_fibroblasts, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg