rs36068360 chr1:203488238 G>C
- Sequence
gaggtggataagatgctcccggcc[G/C]ggcgcggtggctcacgcctgtaat
- ASB in cell types
- upper lobe of left lung uterus
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| upper lobe of left lung | 2.41 | -2.01 | 1.00 | |||
| uterus | -1.75 | 2.26 | 1.00 |
Items per page:
1 – 2 of 2