rs36202220 chr21:10701159 C>T
- Sequence
attggattccattccactcgattc[C/T]gttccatttgattccattcgggtc
- ASB in cell types
- iPSC derived cardiomyocytes
- ASB for transcription factors
- LMNA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| LMNA_HUMAN | 2.80 | -4.75 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1