rs36527 chr19:3977488 A>G
- Sequence
tggctgggcggtcagcacactggc[A/G]tagaggcagcgccgtgctgtgggg
- ASB in cell types
- HIV-1 latently-infected central memory T cells cultured from uninfected primary T cells
- ASB for transcription factors
- BRD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRD4_HUMAN | 0.47 | 2.57 | 2.50 | n/a | n/a |
Items per page:
1 – 1 of 1