rs36669 chr5:36745565 T>C
- Sequence
cacagtactcaggggccagccagg[T/C]gccatcccaggtggcccagcttgg
- ASB in cell types
- 22RV1 (prostate carcinoma) T47D (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | -1.98 | 2.53 | 2.00 | |||
| T47D (invasive ductal carcinoma) | 0.59 | 1.26 | 1.83 |
Items per page:
1 – 2 of 2