rs36929 chr7:123865690 C>T
- Sequence
cagtgtccaaggcctgagaaatac[C/T]atgaggtttggctggtgacacctg
- ASB in cell types
- foreskin keratinocyte prostate gland K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | n/a | 1.24 | 2.67 | |||
| prostate gland | 1.25 | -1.25 | 1.00 | |||
| K562 (myelogenous leukemia) | 0.03 | 0.39 | 1.50 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP diastolic blood pressure (dbp), hdl cholesterol, irritible bowel syndrome, ldl cholesterol change with statins, microalbuminuria, systolic blood pressure (sbp), urinary albumin-to-creatinine ratio